Canine parvovirus-2 (CPV-2) is the aetiological agent of an infectious viral disease of dogs, characterised by diarrhoea and vomiting. Mutations of the CPV-2 genome have generated new variants circulating worldwide. This article reports the molecular analysis of CPV-2 variants collected in the dog population in southeast Anatolia, Turkey. Twenty blood samples previously taken for the laboratory diagnosis of dogs with suspected parvovirus were screened for CPV-2 by polymerase chain reaction (PCR). Of the 20 samples, 18 tested positive for CPV-2. Partial VP2 gene sequencing and restriction fragment length polymorphism (RFLP) analysis revealed CPV-2a (
Canine parvovirus type 2 (CPV-2) causes an infectious viral disease of dogs, characterised by diarrhoea, vomiting and heart failure in pups. Although its origin is still unknown, CPV-2 is probably derived from feline panleukopenia virus (FPV) or FPV-like carnivore parvovirus, which is widespread worldwide with different frequencies (Calderon et al.
In the late 1970s, CPV-2 emerged to become widespread in dog populations worldwide. After an adaptation period, CPV-2 caused a pandemic in dogs in 1978–1980. New antigenic variants, named CPV-2a and CPV-2b, resulted from mutations in CPV-2. In 2001, a new antigenic variant, CPV-2c, with amino acid substitution 426 (Asp→Glu) in the VP2 capsid protein, was found in Italy (Battilani et al.
Vaccination is the only protection from the disease, and inactivated and modified live virus vaccines have recently been used to immunise dogs (Zhou et al.
There have been few molecular characterisation studies of CPV-2 variants in Turkey (
Illustrative map of canine parvovirus-2 variant (2a/2b/2c) locations in the studies.
Studies of canine parvovirus -2 genotyping of dogs in Turkey.
Study year | Regions of Turkey (province) | Variants of CPV - 2 |
Methods | References | ||
---|---|---|---|---|---|---|
2a | 2b | 2c | ||||
2003 | Bursa | 9 | 7 | - | HI | Yılmaz et al. 2005 |
2002–2003 | Bursa | 17 | 10 | - | HI | Yesilbag et al. |
2009–2010 | Ankara | 17 | 8 | - | PCR, Sequence | Timurkan and Oguzoğlu 2015 |
2017 | Mersin | - | 8 | - | PCR, Sequence | Dincer |
2018 | Van | 1 | 3 | - | PCR, Sequence | Karapınar, Dincer and Ozkan 2018 |
2017 | Sanliurfa | 1 | 16 | 1 | PCR–RFLP, Sequence | In this study |
HI, haemagglutination inhibition; PCR, polymerase chain reaction; PCR–RFLP, polymerase chain reaction–restriction fragment length polymorphism.
The aim of this study was to characterise CPV-2 variants, using PCR and restriction fragment length polymorphism (RFLP) methods, from clinically ill dog samples in southeast Anatolia, Turkey (Sanliurfa Province).
Blood samples (
Sample no, age, accession numbers and clinical sings of dogs infected with canine parvovirus.
Sample no. | Sample type | Age (month) | Sex | Vaccination status | Clinical remark | Breed | Year | Type | Accession number |
---|---|---|---|---|---|---|---|---|---|
1 | Blood | 2.5 | F | NV | Anorexia and diarrhoea | Mix | 2017 | 2b | MG780275 |
2 | Blood | 3 | M | NV | Diarrhoea | Mix | 2017 | 2b | MG780276 |
3 | Blood | 2 | F | NV | Diarrhoea | Mix | 2017 | 2b | MG780277 |
5 | Blood | 5 | M | NV | Anorexia and depression | Mix | 2017 | 2b | MG780278 |
11 | Blood | 2 | M | NV | Vomiting | Mix | 2017 | 2b | MG780279 |
12 | Blood | 1.5 | M | NV | Vomiting and diarrhoea | Mix | 2017 | 2b | MG780280 |
13 | Blood | 2 | M | NV | Anorexia and vomiting | Mix | 2017 | 2b | MG780281 |
15 | Blood | 3 | F | NV | Anorexia and vomiting | Mix | 2017 | 2c | MG780282 |
16 | Blood | 2.5 | M | NV | Diarrhoea | Mix | 2017 | 2b | MG780283 |
17 | Blood | 1.5 | M | NV | Diarrhoea | Mix | 2017 | 2b | MG780284 |
18 | Blood | 3 | F | NV | Anorexia and diarrhoea | Mix | 2017 | 2b | MG780285 |
66 | Blood | 3 | F | NV | Anorexia and depression | Mix | 2017 | 2b | MG780286 |
70 | Blood | 2 | M | NV | Anorexia, anaemia and depression | Mix | 2017 | 2b | MG780287 |
100 | Blood | 3 | F | NV | Diarrhoea | Mix | 2017 | 2a | MG780288 |
101 | Blood | 2 | M | NV | Anorexia and diarrhoea | Mix | 2017 | 2b | MG780289 |
102 | Blood | 3 | M | NV | Anorexia and diarrhoea | Mix | 2017 | 2b | MG780290 |
110 | Blood | 1.5 | F | NV | Diarrhoea | Mix | 2017 | 2b | MG780291 |
189 | Blood | 4 | F | NV | Diarrhoea | Mix | 2017 | 2b | MG780292 |
F, female; M, male; NV, non-vaccinated.
CPV-2 genomic DNA was extracted from clinical specimens using a High Pure Viral Nucleic Acid Kit (Roche Diagnostics, Mannheim, Germany) following the manufacturer’s recommendations. Purified viral genomic DNA was eluted in 50
The PCR was performed using Hfor and Hrev primers for detecting the partial VP2 gene (630 base pairs [bp]) of CPV-2, according to the protocol reported elsewhere (Battilani et al.
For RFLP analysis, viral genomic DNA was amplified using 555for-5’-(CAGGAAGATATCCAGAAGGA)-3’ (from 4003 to 4022)/555rev-5’-(GGTGCTAGTTGATATGTAATAAACA)-3’ (from 4585 to 4561) primers to obtain the partial VP2 gene, region (583nt) (Buonavoglia et al.
Restriction fragment length polymorphism analyses of the partial VP2 gene polymerase chain reaction amplicon (583 base pairs) of canine parvovirus-2a/2b/2c variants. Line M: 100 base pairs Deoxyribonucleic acid ladder (Thermoscientific, United States); Line 1: undigested canine parvovirus- 2a; Line 2: undigested canine parvovirus-2b; Line 3: undigested canine parvovirus-2c; Line 4; canine parvovirus-2a undigested with
Sequence analysis was performed on all positive samples. The PCR amplicons were cleaned with a GeneJet PCR Purification Kit (Thermo Fisher Scientific, US) before sequencing in an ABI PRISM 310 Genetic Analyzer (Applied Biosystem, CA, US) with Hfor and Hrev primers for PCR. The sequence data were submitted to the DDBJ/EMBL/GenBank databases under the following accession numbers:
This article followed all ethical standards for research without direct contact with human or animal subjects.
Twenty blood specimens from dogs showing signs of gastroenteritis (bloody diarrhoea, vomiting, etc.) were tested for CPV-2 using PCR and RFLP. Of these samples, 18 were identified by PCR as positive for CPV-2, whereas 2 samples were negative. Restriction fragment length polymorphism and sequence analysis of the PCR products revealed that only one sample was positive for CPV-2c; the other samples were positive for CPV-2a and CPV-2b (
Phylogenetic tree based on the partial VP2 gene of canine parvovirus-2 shows canine parvovirus variants circulating in Sanliurfa, Turkey, and reference sequences. The phylogeny was performed neighbour-joining method based on 1000 replicates by MEGA 6 software. Each sequence is indicated with accession number, country and canine parvovirus-2 variants. In this study, canine parvovirus-2a sequence is indicated with ‘
The dogs were aged between 1.5 and 5 months; 40% (8/20) were female and 60% (12/20) were male. According to the clinical data, the dogs had not been known previously vaccinated. All dogs were of mixed breed.
The partial VP2 gene segment of CPV-2 was obtained using Hfor and Hrev oligonucleotides from the buffy coat (
Amino acid changes in VP2 partial gene of canine parvovirus-2a, canine parvovirus-2b and canine parvovirus-2c.
Aa no. | 297 | 300 | 305 | 316 | 323 | 324 | 336 | 375 | 426 | 440 |
---|---|---|---|---|---|---|---|---|---|---|
M38245 | S | A | D | V | N | Y | V | N | N | T |
MG780275 | A | G | Y | - | - | I | - | D | D | A |
MG780266 | A | G | Y | - | - | I | - | D | D | A |
MG780277 | A | G | Y | - | - | I | - | D | D | A |
MG780278 | A | G | Y | - | - | I | - | D | D | A |
MG780279 | A | G | Y | - | - | I | - | D | D | A |
MG780280 | A | G | Y | - | - | I | - | D | D | A |
MG780281 | A | G | Y | - | - | I | - | D | D | A |
MG780282 | A | G | Y | - | - | I | - | D | E | - |
MG780282 | A | G | Y | - | - | I | - | D | D | A |
MG780283 | A | G | Y | - | - | I | - | D | D | A |
MG780284 | A | G | Y | - | - | I | - | D | D | A |
MG780285 | A | G | Y | - | - | I | - | D | D | A |
MG780286 | A | G | Y | - | - | I | - | D | D | A |
MG780287 | A | G | Y | - | - | I | - | D | - | - |
MG780288 | A | G | Y | - | - | I | - | D | D | A |
MG780280 | A | G | Y | - | - | I | - | D | D | A |
MG780290 | A | G | Y | - | - | I | - | D | D | A |
MG780291 | A | G | Y | - | - | I | - | D | D | A |
FJ197847 | S | - | - | - | - | - | - | E | - | - |
GU212792 | S | - | - | - | - | - | - | E | D | - |
FJ011098 | - | - | - | I | - | - | - | - | - | - |
Note: Homologous amino acid by sign (−).
Amino acid changes in VP2 partial gene of canine parvovirus-2a, canine parvovirus-2b and canine parvovirus-2c.
Aa no. | 297 | 300 | 305 | 316 | 323 | 324 | 336 | 375 | 426 | 440 |
---|---|---|---|---|---|---|---|---|---|---|
aa change | TCT→GCT | GCT→GGT | GAT→TAT | - | AAT→GAT | TAT→ATT | GTA→GTG | AAT→GAT | ATT→GAT | ACA→GCA |
S→A† | A→G† | D→Y† | - | N→N | Y→I† | V→V | N→D† | ATT→GAA | T→A† | |
- | - | - | - | - | - | - | - | AAT→AAT | - | |
- | - | - | - | - | - | - | - | N→D† | - | |
- | - | - | - | - | - | - | - | N→ E† | - | |
- | - | - | - | - | - | - | - | N→ N† | - |
Note: Amino acid substitutions are indicated by dagger (†) and vaccine strains (FJ197847, GU212792, FJ011098). Homologous amino acid by sign (−).
In this study, some amino acid changes were observed at residues 297, 300, 305, 324, 375, 426 and 440 compared to the reference genes (accession number: M38245) (
Canine parvovirus type 2, an important viral agent of domestic and wild canids, causes haemorrhagic gastroenteritis and myocardial disease, especially in the young. Although CPV-2 has a DNA genome, it displays high rates of nucleotide changes leading to the emergence of new variants (2a/2b/2c) (Shackelton et al.
This study provides the first molecular and sequence analysis of CPV-2 strains from the dog population in southeast Anatolia, Turkey. According to Demeter et al. (
In Turkey, the CPV-2c variant has only been demonstrated in cats in Ankara Province (Muz et al.
The VP2 protein, which has amino acid residues at 87, 101, 297, 300, 305, 323, 324, 375 and 440, is a major antigenic determinant that plays a pivotal role in the host distribution of the virus and an important role in modulating host response. Additionally, changes in the VP2 protein amino acid residues may increase pathogenicity (Dei Giudici et al.
Previous studies have reported that CPV-2 variants (CPV-2a/2b/2c) can infect and cause disease in cats through transfer from dogs, although cat-to-cat transfer is also possible (Battilani et al.
Vaccines play a pivotal role in protecting dog populations against CPV infection. Updating currently available vaccines has become important because of the emergence of new variants of CPV. Some studies (Decaro & Buonavoglia
Phylogenetic analysis based on partial VP2-region variants in Turkey demonstrated that, in this study, the sequences were located among viruses from other countries. The vaccine and field viruses formed distinct genetic branches. Specifically, amino acid substitutions are pivotal to genetic complexity and may result in vaccine failure and other disadvantages. New vaccines that include currently circulating strains should therefore be used to ensure appropriate and effective immunisation in Turkey.
Consequently, this study provided the first molecular identification of CPV-2c and demonstrated the circulation of CPV-2a/2b variants in the dog population of southeast Anatolia, Turkey. Moreover, this study offered the first use of RFLP and PCR/sequence analysis for the detection and characterisation of CPV-2 variants from clinical samples obtained from dogs with gastroenteritis in Turkey. Although CPV-2 is a DNA virus, the detected amino acid substitutions indicated that CPV-2 has evolved continuously. These mutations on the CPV-2 VP2 protein may cause currently used vaccines to fail. Regular epidemiological surveys and molecular studies can identify new CPV-2 genetic variants and changes. Future epidemiological and molecular surveys will help to better trace the distribution of CPV-2c and other variants in dogs in Turkey. Moreover, the use of appropriate test systems, such as serological and/or molecular tests, will reveal the real incidence of CPV-2c in field samples in Turkey. Finally, vaccination programmes and the vaccines used in dogs should be revised considering the CPV-2 variants in the field. All the obtained data will enable more effective control of CPV-2 infections in the country.
The authors declare that they have no financial or personal relationships that may have inappropriately influenced them in writing this article.
P.F.P. and A.S. were responsible for the specimen collection and recording of information about each dog. E.D. was responsible for the project planning, laboratory assays and general overview. G.A. was responsible for the data interpretation. E.D. and M.O.T. were responsible for the manuscript preparation. All authors read and approved the final manuscript.
This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.
Additional data not included in this article will be made available on request.
The views and opinions expressed in this article are those of the author(s) and do not necessarily reflect the official policy or position of any affiliated agency of the authors.